Презентация на тему "Что такое биоинформатика?" по биологии

Презентация по слайдам
Слайд №1

Текст слайда: Что такое биоинформатика? Банк SwissProt С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ

Слайд №2

Текст слайда: Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п. ?

Слайд №3

Текст слайда: Биоинформатика Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п.

Слайд №4

Текст слайда: Примеры задач биоинформатики Разработка алгоритмов для анализа большого объема биологических данных Алгоритм поиска генов в геноме Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с другими молекулами. Изучение структуры активного центра белка Разработка программного обеспечения для управления и быстрого доступа к биологическим данным Создание банка данных аминокислотных последовательностей

Слайд №5

Текст слайда: Что понимать под биоинформатикой? Как видим, смысл термина ещё ỳже... Применение компьютерных методов для решения биологических задач Применение компьютерных методов для решения задач молекулярной биологии ... и еще ỳже... Компьютерный анализ экспериментальных данных о структурах биологических макромолекул (белков и нуклеиновых кислот) с целью получения биологической информации

Слайд №6

Текст слайда: Итак... Биоинформатика = вычислительная молекулярная биология Почему так сузился смысл термина?

Слайд №7

Текст слайда: gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac ctctaaactatgtttatctcgatgacgatcctatttcttctgataaattgggttctataa

Слайд №8

Текст слайда: В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в ДНК Организм ДНК «в пробирке» Последовательность выделение секвенирование ...TGCCACAAATCAC...

Слайд №9

Текст слайда: Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’а: 1982: 680 338 букв в 606 последовательностях 1992: 101 008 486 букв в 78 608 последовательностях 2002: 28 507 990 166 букв в 22 318 883 последовательностях 2004: 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~165 000 организмов) Размер файлов — 196 Gb

Слайд №10

Текст слайда: Пионеры биоинформатики Лайнус Полинг 1962 Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225. Zuckerkandl, E., and L. Pauling. 1965. Evolutionary divergence and convergence in proteins. Evolving Genes and Proteins, Academic Press, New York, 97-166. Анализ аминокислотных последовательностей глобинов нескольких позвоночных Гипотеза молекулярных часов

Слайд №11

Текст слайда: Пионеры биоинформатики Маргарет Дейхофф Однобуквенный код аминокислот A,C,D,E,F,G,H… Матрицы аминокислотных замен PAM (Point Accepted Mutation) 1965 Атлас последовательностей белков и их структур (1965)

Слайд №12

Текст слайда: Первый “банк данных” Атлас белковых последовательностей и их структур 1965 -1978 Первая версия атласа содержала описание 65 (!) последовательностей белков

Слайд №13

Текст слайда: Банки данных Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор Курируемые за содержание записей отвечают специальные люди — кураторы Автоматические записи генерируются компьютерными программами

Слайд №14

Текст слайда: Банк данных Swiss-Prot 1986 Swiss-Prot – база знаний о белковых последовательностях http://www.expasy.org/sprot/ Курируемая база данных “Золотой стандарт” аннотации

Слайд №15

Текст слайда: Банк данных Swiss-Prot Амос Байрох Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики С 1987 поддерживается в сотрудничестве между Swiss Institute of Bioinformatics (SIB) European Bioinformatics Institute (EBI)

Слайд №16

Текст слайда: Банк данных Swiss-Prot Статистика роста количества документов Текущий релиз 48.9 (24 января 2006) содержит 206586 документов 1986 2006 2001

Слайд №17

Текст слайда: Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL Автоматическая классификация и аннотация TrEMBL (Translated EMBL) Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа

Слайд №18

Текст слайда: Тенденция объединения 2002

Слайд №19

Текст слайда: Банк данных UniProt UniProt (Universal Protein Resource) UniProt Knowlegebase – SwissProt+TrEMBL UniProt Archive – UniParc UniProt Reference – UniRef

Слайд №20

Текст слайда: ~2 500 000 последовательностей компьютерный поиск гена, трансляция и компьютерная аннотация UniRef (UniProt non-redundant Reference databases) UniParc (UniProt Archive) 200 000 последовательностей Экспертиза Базы данных научной литературы

Слайд №21

Текст слайда: Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206 586 Последовательностей во много раз больше, чем структур! Большинство последовательностей не аннотированы!

Слайд №22

Текст слайда: Документ банка данных Swiss-Prot Описание документа: идентификатор, имя, дата создания и модификации Аннотация последовательности Последовательность

Слайд №23

Текст слайда: Основные поля записи SwissProt ID AC DE OS OC И сама последовательность, конечно.

Добавить комментарий